Human Variation and Race

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis. (5 pts) In looking at Human variation, it is hard to see beyond the color. As humans we have developed on way thinking when it comes to race. We have created stereotypes that are judgmental and actually have no scientific reasoning behind them. This leads to assumptions about people in regards to race that are just illogical. There are many different environmental stresses that can affect race of a region or person. Specifically, let’s look at heat and how it negatively impacts the survival of humans by disturbing homeostasis. Increased heat can be very detrimental to humans and eventually lead to death. When body temperature rises to 105 degrees or more it is considered hyperthermia. Hyperthermia can result in deterioration of internal organs and eventually death.

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total) Four ways in which humans adapt to stress can be categorized into short term, facultative, developmental, and cultural. First a short term way humans react to heat is by sweating. Our bodies use sweating as a way to cool down our core temperature to maintain homeostasis. If it weren’t for sweating, our bodies would over heat very rapidly to the point of no return. Secondly, a facultative adaption to heat is skin pigment darkening, or tanning. When an environment experiences extreme heat, this also means there is an excess of ultraviolet light, which can cause skin pigment to darken. Thirdly, a developmental adaption to heat is body size. Groups that live in areas that have high heat are often very tall and slender. This is because the more surface area your body has, the more heat it releases. This also leads to individuals having longer arms and legs. Finally a cultural adaptation to heat is seen in the clothing. Clothing worn by different cultures in high heat environments are typically more revealing. This is because the more clothes you wear, generates more heat. Therefore in high heat environments, the less clothes the more heat your body will release into the environment, and keep you cool.

3. What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way. (5 pts) The benefits of exploring human variation from the environmental influences perspective are numerous. It allows us to be subjective when looking at our differences. Although humans are a species with very small genetic variations, we tend to put a lot of stress on our variations. This causes us to have stereotypes and subjective reasoning.

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. (10 pts) Again, by looking at the different adaptions to heat it helps us to realize that everything happens for a reason. Skin pigment is a result of environment and that’s it. The traits that make up a culture are different because of environmental pressures and adaptations. Yes, they are different but they all derive from a survival adaptation. Without our differences, we would not be able to habitat most of the environment’s on this planet. So, all in all our differences is what makes us a strong and durable species… so far.

Importance of Language Today

Language Blog Post

                Last week a friend and I did a little experiment. We tried to communicate for 15 minutes where I was not allowed to use any version of a symbolic language, symbolic language meaning no speaking, writing, or other forms of language such as ASL. In the beginning this was very difficult, but after some time my friend began to get the hang of what I was trying to say. I ended up using my hands a lot and some grunting noises to convey what I was trying to say. My friend however communicated with mostly questions that started to shape the conversation. A lot of the time she was just guessing what I was trying to explain. Normally, this particular friend and I talk a lot about different things all the time, but when you are forced to communicate this way for 15 minutes, I had to carefully choose what to talk about. At first she was confused and I could tell she was a bit frustrated. She had these moments of just looking at me with an “uhhhhhhhhh?” kind of expression, which frustrated me in return. After this frustration, she did change her communication to mostly questions that required simple answers.

                If we were to represent two different cultures, I would imagine it a lot like the first communication between American Indians and the Explorers of the new world. In this scenario, I would have represented the American Indians and my friend, the English speaking explorers. I think that the English speaking explorers would be able to communicate more complex thoughts and plans as compared to the Indians. This would be a great advantage to the Explorers and would end up in the Explorers thinking less of the Indians because of their inability to speak and communicate the same way.

                Today, in our culture people who have lost their hearing have a similar struggle. Of course, there are many tools available to help, however there is still a struggle with their communication. I actually went to school with someone who was deaf and it was interesting to see the interaction between other students, like myself, and him. Although he seemed like a really nice guy, I never really approached him because I wasn't sure how. It wasn't that I thought he was any less of a person, but I just was afraid of looking like a fool and not being able to communicate with him. He of course had his friends, and they all used American Sign Language to communicate with him, but I had no knowledge of how to do that. It definitely hindered me in that situation and makes me realize how important verbal communication actually is.

                The next day, we did another experiment in which we were to communicate with just speaking and nothing else. This means no vocal annotation or any facial or body movements of any kind. I am really an expressive person so it was extremely hard for me to speak without facial expressions and especially without variations in my voice.  My first couple of sentences, I had to start over because I smiled or raised my voice when asking a question. After we were done with the conversation she said she felt like I was a robot a little and that I had no emotions. This made me realize that through our language we actually use a lot of non-verbal signs and body language to convey our points. When we are talking about something funny, we usually smile and in return that conveys an emotion. I didn't realize how much emotion plays a role in our communication also.

                When thinking about someone who has difficulty reading body language, immediately Autism came to mind. Autistic people have difficulty reading body language and picking up on social ques. Although, I have not known anyone with Autism, I do imagine that it would be a difficult thing to deal with. It seems like this would result in a lot of mis-communications. I think we as humans rely a lot on body language to send certain messages and those messages can be missed easily. However, an environmental situation where it may be beneficial to not read body language could be when meeting new cultures. Different cultures have different body language and symbols that can mean different things. It would be beneficial in this situation to not approach it with a predetermined set of meanings.

                In conclusion, this assignment has made me very grateful for our speech abilities and the different ways we can communicate. I think human communication lets us covey very complex thoughts and emotions and in a way is what defines us as humans. Language enables us to grow and learn at a very rapid pace as opposed to other species.

The Piltdown Man Hoax Revisited

            The Piltdown Man was discovered in the early 1900’s in a southern English town called Sussex. Charles Dawson found the remains of, what he said, was an ancient human skull. Arthur Smith Woodward and Pierre Teilhard de Chardin were also summoned to validate the discovery. The jaw was very animal like however it contained human teeth. This led scientists to believe that this specimen was an ancient human fossil that showed evolutionary connections between humans and apes. Also, that humans developed big brains before they walked up right which was the personal theory of Arthur Keith.  Another aspect to this discovery that was so astounding was that there had never been any early human discoveries made in Britain before. However, this group of scientists continued to search in that same location and found several more artifacts, which quickly deterred any doubt in the validity of the discovery. It seems that at the beginning the discovery was so unbelievable that many did not believe it, but then took it at face value.

The Piltdown Man Hoax brings to light human error in science. Like mentioned in the video, scientists during that time were considered to be gentlemen and that is why people were so stunned by this fraud. However, I think we tend to forget that scientists are humans just like the rest of us. With humans, come human nature and the typical greed and success driven motivations. Humans have a tendency to place greed as a number on motivation in their day to day lives and in this situation, I think that was the case.

After the skull was discovered, it was locked away in the Natural History Museum, and no one really had access to it. Because of the prominent names that were backing up this discovery, not many people thought to question or challenge it. However, where science seems to have shown through is with the scientific method.  Scientists chose to date the Plitdown Man fossils, once the dating technology was created. Even though, Piltdown man was discovered a while before that, scientists still desired to prove the validity of the fossils.

I do not think it is possible to remove the human factor in science.  Even though science is based upon facts, there is still some sort of interpretation and bias involved. Much like a few chapters ago when we learned about the scientific method and bias in science, that bias is still evident today. Although there are negatives to human nature, there are also some positives. The drive to make new discoveries and explain our evolution is what drives science today in my opinion. Without it, we probably wouldn’t have discovered as much as we have already. So even though there are some down sides, there are equally as many advantages. The only thing we can do in the future is continue to learn and stick to the scientific method.

The Piltdown Man Hoax has taught the scientific community a lot. There is also a psychological stand point at play here in regards to authority. In human nature it is common for us to believe something, or take it at face value, if the information is coming from an authoritative person. In this case, the Piltdown Man was being supported by very important members of the science community and evolution discoveries. In a sense, they are considered an authority in the scientific community, and therefore people just believed them. If scientists were to stick with what they know and always verify sources and test hypothesis, then they would have found out much sooner that it was a fake.

Body Size and Sexual Dimorphism?.... Party of 5!

Lemur

There are several different species of Lemurs and all of which live in the top of the rain forest. The body size of lemurs can range from 1 ounce to 15lbs. However, even though there is a large size variety, there is no size difference between the sexes. One sexual dimorphism that is seen is the variance of color between one specific species, the Black Lemur. In this case the male is black while the female lemur is brown (pictured below). In analyzing the body size of the lemur and their environment, I would say that the environment definitely has an impact on the body size of lemurs. They need to be small and agile in order to navigate the top of the rain forest and climb through trees.

 Spider Monkey

Spider monkeys also live at the top of the forest in the tree canopy. They feast on nuts and other vegetation. One sexual Dimorphism of Spider monkeys is the body size of males and females differ. Males usually range around 24lbs while females are around 21lbs. Because the Spider monkey is larger than most canopy primates, they utilize their long tails to maneuver the trees. Their environment in the canopy affects the body size of the Spider Monkey in their large tails. If they did not have the need to maneuver in the trees, then possible their tails would be smaller.

Baboon

Baboons are a larger primate and can vary anywhere from 30lbs to 90lbs. Most species of Baboons live in Africa or Arabia. They tend to prefer savanna or other arid habitats. This primate is not typically seen in trees like the two previously mentioned. There is a strong case of sexual dimorphism in this species seen in body size, color and even canine development. Female baboons can weigh around 40lbs while males typically weigh double the female, at 80lbs. Also, in Hamadryas baboons, the male baboon typically has a long mane type hair around his face (see below). In the picture below you can see the size difference and color variation between the male and female baboons. In the case of Baboons, it is hard to tell if the body size and sexual dimorphism is a reflection of their environment. However, in looking at the picture below I definitely thing the coloration of the two baboons would help to disguise them in an arid environment.

Gibbon

Gibbons primarily live in the tropical rain forests. There they can be seen swinging from branch to branch reaching up to 35mph. Gibbons display sexual dimorphism in their coloring. Depending on sex, Gibbons can vary from light brown to dark brown and even black to white. Also, males tend to weight around 16 lbs and are larger than females. Similar to the spider monkey and lemurs I think the Gibbons body size is affected buy their environment. The gibbons have to be small enough to maneuver through the trees but they also use their long arms to swing from tree to tree very quickly to get food or avoid enemies. 

                                                  

Chimpanzee

Chimpanzees are found in Africa. They typically live in tropical rainforests, but continue to adapt to their ever changing environment as needed. Chimpanzees are the largest species discussed here. A male chimpanzee can weigh as much as 150lbs. Chimpanzees show sexual dimorphism in size because the males are slightly larger than the females. Chimpanzees are very versatile creatures and can be seen gathering food or sleeping in trees, but they also “Knuckle walk” on the forest floor. Chimpanzees are really suited for their environment. I think at one point the chimpanzees environment pushed them to be able to knuckle walk and not just swing from tree to tree. This may have been caused by low food sources in the tops of the trees. 

Homologus Vs Analogous Traits

Homologus Traits

The Homologus trait between a bird and a rabbit is that they both share that same forelimb that consists of the humerus, radius and the ulna. The forearm of a bird and the forearm of a rabbit seem to be completely different however, they are made up of the same bones. Obviously the main difference between the two animals is that a rabbit cannot fly like a bird can. These homologus traits seem to look different on the outside, but on the inside their bone structure is the same. Throughout its evolution, birds evolved into having long and thin forearms better suited for flying. However, in the meantime rabbits evolved into having more weight bearing forearms to help them hop around better and move faster to avoid predators. In this example, the Eusthenopteron is the common ancestor between all tetrapods. This is known because this is where the development of the humerus, radius and the ulna began

 

Analogous Traits

An example of an analogous trait is fins. For example, both dolphins and sharks have fins and they both serve the same purpose to help the animal swim. Because of several similarities, such as living in the sea and having fins you would think they are closely related but they are not. These fins are similar in shape, size and purpose, however, just because they have the same fins, does not mean they have the same direct ancestor. In fact a dolphin is considered a mammal while a shark is a fish. The fact that they are both two different animal types shows us that they cannot share a common ancestor but it is possible that if you go far enough back they will at some point share an ancestor. It is possible that the same ancestor would have a fin, but it is hard to tell.

Protein Synthesis

Hey everyone,

OK, let's see how you do! Here is my DNA strand, please comment below with your translation.

TTGATACCAAGGGAACGTCGTTAGTGGCTGAAATCATGAGCGCATCAATC

Thanks!
Amanda

The Evolutionary Contributions of Thomas Malthus

I believe that the research and beliefs of Thomas Malthus directly influenced those of Charles Darwin and his theory of Evolution through Natural Selection. I believe this influence to have been positive in explaining the first step of how evolution works. In reference to a passage about Thomas Malthus found on a UCMP Berkeley Website ( http://www.ucmp.berkeley.edu/history/malthus.html ), he believed that plants and animals produce more offspring than what can survive. He believed the same about man and that poverty and famine were a divine intervention from god used to control the population. Although this belief differs from that of Darwin, the basic principals of it do relate, that all organisms have the potential of reproducing exponentially.

Darwin took that basic principal and refined it, saying that yes all organisms produce more offspring than what can survive, but the factors that lessen the populations are not divine, but natural. Darwin believed that natural causes, as well as genes, can shape a population over time so they adapt to their surroundings and he supported this by providing evidence through fossils.

I believe that Darwin could not have  developed his theory of natural selection without Thomas Malthus. I feel like over population is the first key to studying the need for natural selection. Although Darwin took his idea and refined it, I feel that Malthus' ideas are what sparked that whole realization that the populations can be affected by other sources.

In conclusion, I believe that the attitude of the church is what really delayed the eventual publication of his book On the Origin of Species because he really did worry about his reputation. According to the video "Who was Charles Darwin?" he was a well known and respectable man from a well known family. He know his ideas would challenge the church and the beliefs of other naturalists. However, with the help of his brother he decided to collect his thoughts and publish them through his book.